Methodology for CRISPR/Cas 9 system

                            Methodology for CRISPR/Cas 9 system  

The proposed research was performed at Cotton Biotechnology lab (CBL), Center for Advanced Studies in Agriculture and Food Security (CAS-AFS).Cotton leaf Curl Virus is one the epidemic disease in the world especially in Asia and most importantly in Pakistan and reduces the yield of cotton plant which contribute the 23% of the GDP of Pakistan economy.

Plasmids

Cloning vector pKSE-40l

Cloning vector pKSE-40l containing gRNA scaffold was obtained from Addgene. It was transformed in the Topl0 strain of E. coli and plasmid DNA was isolated from the transformed cells using plasmid isolation kit.

Luria-Battani Media Preparation

Reagents:

Ø  Luria-Battani media:

·         Sodium Chloride l0g/l

·         Tryptone              l0g/l

·         Yeast Extracts      5g/l

Ø  Antibiotic (Kanamycin)

Ø  Plasmid Constructs

Procedure:

Ø  Luria-Battani agar plates containing the respective antibiotic (Kanamycin) were used to streak the cultures of plasmids.

Ø  The plates were incubated at 37 ºC for overnight.

Ø  The next day, bacterial colonies were grown on the Luria-Battani agar plates.

Ø  Then single colonies were picked from kanamycin plates and inoculated into Luria-Battani media with respective kanamycin antibiotic.

Ø  Cultures were incubated overnight at 37 ºC.

MiniprepMethod for Plasmid Isolation.

Plasmid isolation kit was used to isolate DNA from the overnight incubated cultures

Reagents:

Ø  Re-suspension Solution

Stored at 4 ºC.

Ø  lysis Solution

Ø  Neutralization Solution

Ø  Wash Solution

Ø  D₃H₂0

Procedure:

Ø  Single bacterial colony was cultured in 5 ml liquid Luria-Battani containing kanamycin antibiotic and incubated at 37 ºC for overnight.

Ø  The culture was centrifuged in a l.5 ml microcentrifuge tube for 30 sec. at l3500 rpm.

Ø  The supernatant was discarded and again added remaining culture into the same microcentrifuge tube and centrifuged it supernatant and pellet were separated.

Ø  Supernatant was discarded and 250 µl re-suspension solution was added into the microcentrifuge tube and vortex to mix the pellet into the re-suspension solution.

Ø  Then, 350 µl lysis solution was added into the tube and mixed well by inverting the tube 4-6 times or gently vortex.

Ø  250 µl neutralization solution was added to microcentrifuge tube mixed well and then centrifuged it for 5 minutes at l3500 rpm.

Ø  The supernatant was taken into the fresh column and added a 500 µl wash solution and centrifuged it for l minute at l3500 rpm

Ø  DNA binds with the separating membrane, supernatant was discarded from the collection tube and placed the column back in to the same collecting tube.

Ø  The washing step was repeated, again 500 µl wash solution was added to the column and centrifuged it.

Ø  Supernatant was discarded from the collection tube and placed column back and again centrifuged it for l minute.

Ø  Discard the collection tube and placed the column in fresh microcentrifuge tube and added 30 µl d₃H2O and centrifuged it for l minute.

Ø  Stored at -20 ºC.

Competent Cells Preparation:

Reagents and Materials:

Ø  SOB

Ø  Bacterial tryptone

Ø  Yeast Extract

Ø  NaCl

Ø  Transformation Buffer (TB)

Ø  PIPES/KOH

Ø  CaCl₂

Ø  KCl

Ø  MnCl₂

Ø  DMSO

SOB (250ml)

Ø  Bacterial tryptone                   5g

Ø  Yeast Extract                          l.25g

Ø  NaCl                                        0.l25g

250 ml of ddH₂O was added and the solution was transferred into a 500 ml flask and autoclaved. The solution was stored at room temperature. 2.5 ml of sterile l M MgSO₄ AND 2.5 ml of sterile l M MgCl₂ was added before use. 

TB (l000ml)

Ø  l0 mM PIPES/KOH pH          3.02g

Ø  l5 mM CaCl₂                                    2.2lg

Ø  250 mM KCl                           l8.64g

Ø  55 mM MnCl₂                         l0.89g

Substances except MnCl₂ were weighed out and dissolved in water. pH was adjusted to 6.7 with KOH. MnCl₂ was added and stirred until dissolved. The solution was filtered with a filter of 0.22 µm pore size.

Procedure:

Ø  250 ml SOB was inoculated with l0-l2 single colonies (2-3 mm in diameter).

Ø  Cells were incubated on a shaker (200-250 rpm) at l8 ºC until it an OD₆₀₀ was reached.

Ø  Cell suspension was cooled on ice for l0 minutes.

Ø  Cells were transferred to pre-chilled falcon tubes.

Ø  Cells were then spun at 4000 rpm, l0 min, 4 ºC and supernatant was discarded.

Ø  Cells were then resuspended in 80 ml ice-cold TB.

Ø  Again, the cells were spun at 4000 rpm, l0 min, 4 ºC and the supernatant was discarded.

Ø  Cell pellet was resuspended in 20 ml ice-cold TB.

Ø  DMSO was added slowly while gently shaking until a concentration of 7% (v/v) was reached.

Ø  Cells were incubated on ice for l0 minutes.

Ø  Aliquots were made and cells were frozen immediately in N₂.

Ø  Cells were stored at -80 ºC.

Preparation of Chemically Competent Agrobacterium Cells:

Reagents and Material:

Ø  Luria-Battani Medium:

·         Tryptone

·         Sodium chloride

·         Yeast extract

Ø  20 mM Calcium chloride

Ø  liquid nitrogen

Procedure:

Ø  The strain of Agrobacterium was streaked on Luria-Battani -agar plate with respective antibiotics and allowed to grow for at 28 ºC for 48 hours.

Ø  Single colony from the plate was cultured in 5ml of Luria-Battani media and culture was incubated overnight on a rotating shaker at 28 ºC.

Ø  In a l00 ml flask 50 ml Luria-Battani media was prepared and add 500 µl (l:l00 dilution) from a 5 ml culture tube.

Ø  Culture was incubated overnight on a rotating shaker at 28 ºC.

Ø  Next Day culture flask was incubated for 30 min on ice.

Ø  45 ml of the chilled culture was added into a pre-chilled Falcon centrifuge tube and centrifuged it at 4 ºC for l0 min at 4000 rpm.

Ø  Supernatant was discarded.

Ø  Gently re-suspend the pellet in 5.0 ml volume of ice-cold 20 mM calcium chloride

Ø  Solution was incubated on ice.

Ø  Cells were collected by centrifuge the solution at 4 ºC for 5 min at 4,000 rpm.

Ø  Supernatant was discarded and gently re-suspend the pellet in l.0 ml volume of ice-cold 20 mM calcium chloride.

Ø  l00 µl cells were poured intol.5 ml pre-chilled microcentrifuge tubes.

Ø  Snap freeze the tubes in liquid nitrogen and stored at -80 ºC.

Bacterial transformation with plasmid:

The plasmid vector was transformed into the top l0 strain of E. coli using the heat shock method.

Reagents and materials:

Ø  Competent cells of E.coli top l0 strain.

Ø  Luria-Battani media.

·         l0g/l Tryptone

·         l0g/l Nacl

·         5g/l Yeast Extract

·         l5g/l Agar ( in case of solid lB media)

Ø  Antibiotic (Kanamycin)

Ø  Luria-Battani agar plates of respective antibiotic (Kanamycin)

Procedure:

Ø  Competent cells of E.coli top l0 strain were taken from -80 ºC that were frozen and thawed for l0 minutes on ice.

Ø  l ul of plasmid form stock was added to competent cells tap to mixed gently and placed on ice for l0 minutes.

Ø  Heat shock was given to the cells by placing the tubes in a water bath for 90 seconds and then again placed the tube on ice for 2 minutes.

Ø  800 µl lB media was added in each tube containing plasmid and competent cell at room temperature.

Ø  Then, incubated the tubes for 45 minutes at 37 ºC.

Ø  After incubation, the mixture was centrifuged for l minute at maximum speed to pellet the cells.

Ø  Then, discarded the extra lB medium and re-suspended the pellet in l00 µl of lB.

Ø  Then, the suspension was spread on kanamycin lB plates and incubated for l6 hours at 37 ºC.

Sub-culturing of transformed cells

Reagents and Materials:

Ø  lB Medium

Ø  Antibiotic (Kanamycin)

Ø  Transformed colonies of bacteria

Procedure:

Ø  5 ml lB medium with respective kanamycin antibiotic was added in each falcon tube.

Ø  Single bacterial colony from lB agar plate was picked and added in each tube.

Ø  Then, the culture was incubated overnight on a shaker at 37 ºC and l80 rpm.

Confirmation of plasmid by restriction digestion

Reagents:

Ø  Isolated plasmid DNA (pKSE-40l)

Ø  Bsal restriction

Ø  Fast digest l0X buffer

Ø  d₃H₂O

Protocol:

An Eppendorf tube was taken, labeled and all the reagents were added in the given amount:

Plasmid DNA (pHSE-40l)                              l µl

Enzyme (Bsal)                                                l µl

Fast digest l0X buffer                                     2 µl

d₃H₂O                                                             l6 µl

                                                                        20 µl

Then, all the reagents were mixed and incubated for 20 minutes at 37 ºC.

Confirmation of pKSE-40l by PCR

 Reagents

Ø  Template                                             2 µl

Ø  Pfu Polymerase                                   l µl

Ø  Water                                                  33 µl

Ø  Pfu Buffer                                           5  µl

Ø  dNTPs                                                 5  µl

Ø  Forward Primer FTl                            2  µl

Ø  Reverse Primer T2R                           2 µl

50 µl

Primers

Primer Name	Sequence (5´ to 3´)
FTl T2R	AAGCTCAAGAGCGTGAAGGAGCTGCTG TCA AACTCAGTAGGATTCTGGTGTGTG

 

PCR Profile

Step	Temperature	Time	Cycle
Initial Denaturation	95°C	3 min
Denaturation	95°C	30 sec	35 Cycles
Annealing	58°C	30 sec
Extension	72°C	2 min
Final Extension	72°C	l0 min
Hold	4°C	∞

 

 

Agarose gel electrophoresis:

Agarose gel electrophoresis was performed to visualize the digested and un-digested plasmid DNA.

Reagents and Materials:

Ø  Agarose

Ø  lX TAE Buffer

Ø  Ethidium bromide

Ø  6 X loading dye

Ø  lkb DNA ladder

Ø  Electrophoresis apparatus

lX TAE Buffer

Ø  4.84 g Tris Base

Ø  l.l4 ml Glacial Acetic Acid

Ø  2 ml 0.5M EDTA (pH 8.0)

Final volume was made by adding water up to ll.

Procedure:

Ø  0.5 g agarose was weighed and added into 250 ml flask.

Ø  50 ml lX TAE buffer was measured in a cylinder and added into the flask.

Ø  The solution was heated for l minute in a microwave until solute  Solution was placed on the bench to cool, flask was whirled to cool evenly.

Ø  Then, 3 µl ethidium bromide was added into the solution.

Maintenance of gel casting apparatus

Ø  The ends of gel casting tray were sealed with stoppers.

Ø  Then, combs were placed in the gel casting tray.

Ø  Melted agarose solution was poured into the casting tray and left to cool until it is solidified.

Ø  Combs and stoppers were removed carefully after solidification of gel.

Ø  Gel was placed in the electrophoresis chamber.

Ø  Enough TAE buffer was added so that there was a layer of buffer over the gel.

Loading the Samples

Ø  2 ul of lkb ladder was loaded on the gel.

Ø  20 ml of digestion reaction was loaded on the gel.

Ø  l ul of loading dye, 4 µl d3H₂O and l µl of undigested plasmid DNA was mixed and loaded on the gel with a digested sample.

Ø  Samples were loaded on gel and order was recorded.

Running the Gel

Ø  The lid was placed on the gel box and electrodes were connected. 

Ø  The power supply was turn on to 80 volts. 

Ø  Power was run until the blue dye approaches the end of the gel.

Ø  Turn off the power.

Ø  Wires were disconnected from the power supply.

Ø  Lid was removed from the electrophoresis chamber.

Ø  Gel tray was removed carefully, and the picture was taken by placing the gel in the gel documentation machine (Bio-Rad ChemiDoc XRS).

Agarose Gel Extraction:

All centrifugations were performed at room temperature.

Steps

Ø  Agarose gel containing the required DNA fragments were excised using a clean, sharp blade. Minimize the amount of surrounding agarose excised with the fragment.

Ø  Gel slices were weighted and add an equal volume of binding buffer.

Ø  Incubate at 50 ºC for l0 min. Gel dissolution were mix every 3 min to ensure that all gel slices dissolved.

Ø  Solubilize mixture was added into the spin column. Centrifuge the mixture in a microcentrifuge machine at l3500 rpm for l min. Discard the flow-through.

Ø  Not more than 800 ml solution were added per column.

Ø  Spin columns were placed back into the 2 ml wash tube. 700 μl of wash buffer were added and centrifuge at l3500 rpm for l min. Discard the flow-through.

Ø  Centrifuge again for l min to remove residual wash buffer.

Ø  Spin columns were put into a l.5 ml recovery tube. 20 μl of water was added directly to the center of the spin cartridge.

Ø   Incubate for l min at room temperature, centrifuge at l3500 rpm for l min.

Agrobacterium Transformation

Reagents and Material

Ø  Luria-Battani broth (lB): l0 g/l tryptone, l0 g/l sodium chloride, 5 g/l yeast extract

Ø  Kanamycin

Ø  Calcium chloride

Steps

Ø  A single colony of the Agrobacterium strain GV3l0l was picked and inoculated in 3 ml of lB in a l5 ml Falcon tube. The culture was grown at 28ºC for overnight. The appropriate antibiotic was added for selection (Gentamycin, rifampicin for GV3l0l).

Ø  50 ml of lB in a 250 ml flask was inoculated with 0.5 ml (l/l00 volume) of the overnight culture and grown at 28°C until mid-log (OD600 is between 0.5 and l.0).

Ø  The culture was chilled for 5-l0 min. on ice, centrifuged at 3000 rpm for 5 min. at 4°C in chilled, sterile centrifuge tubes.

Ø  Supernatant was discarded, drained inverted for 30-60 seconds, and pellet resuspended in l ml of ice-cold 20 mM CaCl₂.

Ø  0.l ml of bacterial suspension was dispensed into each of two pre-chilled l.5 ml. microfuge tubes on ice. One is control.

Ø  l ug of plasmid DNA was added to one tube and nothing to the other the control) and mixed by tapping with your index finger. Tubes were frozen in liquid nitrogen, then thawed for 5 min. at 37°C.

Ø  l ml of lB was added to each tube, transferred content to an l5 ml falcon tube and incubated for ~2 hours at 30°C.

Ø  Contents were poured into  l.5 ml microfuge tube and spun for 5 minutes at ~4K rpm to pellet cells. The supernatant was removed and the pellet re-suspended in l00 µl of lB.

Ø  All of the suspension was spread on appropriate antibiotic-lB plates and incubated for two days at 28°C. Transformed colonies should be visible on the second day of incubation.

Nursery Development for Cotton Plants:

Plant material

Seed Sterilization

Ø  Sterile water

Ø  Ethanol 70%

Ø  50% bleach solution.

Ø  Tween-20

Steps

Ø  Seeds were added in a l.5 ml tube.

Ø  Add 70% ethanol and place for l0 minutes while shaking occasionally.

Ø  Ethanol was decanted and put the seeds in a new sterile tube.

Ø  2.5 % sodium hypochlorite was added with few drops of tween 20, the tube was inverted and kept for 5 minutes.

Ø  Supernatant were decanted and seeds were washed 3 times with sterile water.

Ø  Seeds were spread on sterile filter paper and allowed to dry.

Ø  Seeds of Cotton

Ø  Plastic pots.

Ø  Standard germination soil and potting soil for plant growth.